View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10273_low_82 (Length: 228)
Name: NF10273_low_82
Description: NF10273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10273_low_82 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 7 - 205
Target Start/End: Original strand, 43802265 - 43802463
Alignment:
| Q |
7 |
attgtatcaattggaaatactagagtagaaccttcgttgtataaaaaggttatcatcataatgagaatacaagcaacgtttcacatcataatgatggatg |
106 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43802265 |
attgtatcaattggaaatactagagtaaaaccttcgttgtataaaagggttatcatcataatgagaatacaagcaacgtttcacatcataatgatggatg |
43802364 |
T |
|
| Q |
107 |
cagtggtgaccctaagaacgggtgggatgggctctaacttttcagaggcaccaacaaagtttttgcattgtagtattataaatattaaaattaaaactg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43802365 |
cagtggtgaccctaagaacgggtgggatgggctctaacttttcagaggcaccaacaaagtttttgcattgaagtattataaatattaaaattaaaactg |
43802463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University