View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10273_low_85 (Length: 227)
Name: NF10273_low_85
Description: NF10273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10273_low_85 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 19 - 210
Target Start/End: Complemental strand, 9283611 - 9283420
Alignment:
| Q |
19 |
acaacagcttacatttacaatattagcagtaaggatgataattagaatctagactttctgtcatatattgttgcagcaactatttatttagcttta-ttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
9283611 |
acaacagcttacatttacaatattagcagtaaggatgataattagaatctagactttctgtcatatattgttgcagcaactatttatttagctttatttt |
9283512 |
T |
 |
| Q |
118 |
attgttgttgaaacagtcattatgaattacttttgttctctgtacattttggtgtgttttgtctctttgatcgtgtcgaaatgttgttgctct |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9283511 |
attgttgttgaaacagtcattatgaattacttttgttctctgtacattttggt-agttttgtctctttgatcgtgtcgaaatgttgttgctct |
9283420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University