View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10273_low_86 (Length: 222)

Name: NF10273_low_86
Description: NF10273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10273_low_86
NF10273_low_86
[»] chr7 (2 HSPs)
chr7 (26-115)||(45647128-45647217)
chr7 (181-212)||(45647031-45647062)


Alignment Details
Target: chr7 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 26 - 115
Target Start/End: Complemental strand, 45647217 - 45647128
Alignment:
26 ttcatatagagcatataactttcatgctaattattacttatataagcaagattaattataaggatcgataagctggaaataattagttcc 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45647217 ttcatatagagcatataactttcatgctaattattacttatataagcaagattaattataaggatcgataagctggaaataattagttcc 45647128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 181 - 212
Target Start/End: Complemental strand, 45647062 - 45647031
Alignment:
181 caatcatgtaatttggcctaccaacacctttg 212  Q
    ||||||||||||||||||||||||||||||||    
45647062 caatcatgtaatttggcctaccaacacctttg 45647031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University