View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10273_low_87 (Length: 212)
Name: NF10273_low_87
Description: NF10273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10273_low_87 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 109; Significance: 5e-55; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 82 - 194
Target Start/End: Original strand, 25013045 - 25013157
Alignment:
| Q |
82 |
ggtaacattacagaagaaagaaacacaatacatatatacctagtgatgtgaaaataattaatggtattcaagtgaaatgctttgttttggtgttttgatt |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
25013045 |
ggtaacattacagaagaaagaaacacaatacatatatacctagtgatgtgaaaataattaatggtattcaagtgaaatgctttgttttggtgttttgctt |
25013144 |
T |
|
| Q |
182 |
gtggtgatgaata |
194 |
Q |
| |
|
||||||||||||| |
|
|
| T |
25013145 |
gtggtgatgaata |
25013157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 25012645 - 25012687
Alignment:
| Q |
1 |
caacactttgacgatccagaatgatcaatttatgtaattgtta |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25012645 |
caacactttgacgatccagaatgatcaatttatgtaattgtta |
25012687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 112 - 192
Target Start/End: Original strand, 37389869 - 37389949
Alignment:
| Q |
112 |
catatatacctagtgatgtgaaaataattaatggtattcaagtgaaatgctttgttttggtgttttgattgtggtgatgaa |
192 |
Q |
| |
|
|||| ||| |||||| ||||||||||||||| ||||||||||||||| || ||||||||||||||| |||||||| |||| |
|
|
| T |
37389869 |
catacatatctagtggggtgaaaataattaattgtattcaagtgaaattctctgttttggtgttttgtttgtggtggtgaa |
37389949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University