View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10273_low_89 (Length: 207)
Name: NF10273_low_89
Description: NF10273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10273_low_89 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 18 - 193
Target Start/End: Complemental strand, 24212408 - 24212233
Alignment:
| Q |
18 |
acattgtaggttgaggtgctgacaccgttgttttcatcgtagatgactgcaacgtggcctactcctgccagctgagcagcctgaattacttgcaaggcat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | |
|
|
| T |
24212408 |
acattgtaggttgaggtgctgacaccgttgttttcatcgtagatgactgcaacgtggcctacgcctgccagctgagcagcctgaattacttgcaaggcgt |
24212309 |
T |
|
| Q |
118 |
ctgacgtggatacctcagttgctggaccgttctctgtgagaccaatggtgacaaccactttgcttgcattgcctat |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24212308 |
ctgacgtggatacctcagttgctggaccgttctctgtgagaccaatggtgacaaccactttgcttgcattgcctat |
24212233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University