View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10274_high_17 (Length: 281)
Name: NF10274_high_17
Description: NF10274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10274_high_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 17 - 270
Target Start/End: Complemental strand, 26257918 - 26257665
Alignment:
| Q |
17 |
agcaaatgcaaaaggctatacacaagcaaacacgcaagcatatgctcaaggctatgcacgagcatacgcgcaaggatgtgcacaagcatatgcagaagga |
116 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26257918 |
agcaaatgcaaaaggctatgaacaagcaaacgcgcaagcatatgctcaaggctatgcacgagcatacgcgcaaggatgtgcacaagcatatgcagaagga |
26257819 |
T |
 |
| Q |
117 |
tacgcgcaaggtttcatttgcagccaattcaaacatgcacttactttggacaaaaagtaactttctttttggcataaaatctgctactgacattggaatt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
26257818 |
tacgcgcaaggtttcatttgcagccaattcaaacatgcccttactttggacaaaaagtaactttctttttggcaaaaaatcggctactgacattggaatt |
26257719 |
T |
 |
| Q |
217 |
taccttctgttttctacttcaaaataaaagctatcatatgctttagtctttctt |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
26257718 |
taccttctgttttctacttcaaaataaaagctattatatgctttagtctttctt |
26257665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University