View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10274_high_30 (Length: 203)
Name: NF10274_high_30
Description: NF10274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10274_high_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 23 - 178
Target Start/End: Complemental strand, 23129145 - 23128990
Alignment:
| Q |
23 |
aggtgctacatctctttttacttttccggacatggtagcaaaatgcaagaaaactcctgagaaaatgttcagaactcttgatttatatgaagcaatttca |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
23129145 |
aggtgctacatctctttttacttttccggacatggtagcaaaatgcaagaaaactcctgagaaaatgttcagaactcttgatttatacgaagcaatttca |
23129046 |
T |
 |
| Q |
123 |
gatcattttcaacaaattcaatcgattttctcgtttgaatcaacttccaacgtccg |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23129045 |
gatcattttcaacaaattcaatcgattttctcgtttgaatcaacttccaacgtccg |
23128990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 60 - 124
Target Start/End: Complemental strand, 41103291 - 41103227
Alignment:
| Q |
60 |
gcaaaatgcaagaaaactcctgagaaaatgttcagaactcttgatttatatgaagcaatttcaga |
124 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| ||||||||||| ||||| |||||||| |
|
|
| T |
41103291 |
gcaaaatgcaagaaaactccggagaaaatgttcagaacgcttgatttatacgaagcgatttcaga |
41103227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University