View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10274_high_6 (Length: 447)
Name: NF10274_high_6
Description: NF10274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10274_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 405; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 405; E-Value: 0
Query Start/End: Original strand, 1 - 434
Target Start/End: Complemental strand, 3713618 - 3713189
Alignment:
| Q |
1 |
tggtcggtaaataaagacatcgaacaactacaattttggagacagatgaattttgcagatcatatatacttgatgctaatttgctgaaaatcttaattcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3713618 |
tggtcggtaaataaagacatcgaacaactacaattttggagacagatgaattttgcagatcata----cttgatgctaatttgctgaaaatcttaattcc |
3713523 |
T |
 |
| Q |
101 |
gtatcagttggttcagttatagtatatcccttatggtagggatggtcaatgagatgtccctagtgtttaaaaatgatctgaaaatacgggttggggagac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3713522 |
ctatcagttggttcagttatagtatatcccttatggtagggatggtcaatgagatgtccctagtgtttaaaaatgatctgaaaatacgggttggggagac |
3713423 |
T |
 |
| Q |
201 |
aaatgtggacccttgatatcttcagcttcgtttcaaggttcatctttccaaacacctgcatgttctcttaaagatccccttctatcccatacaaaaccta |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3713422 |
aaatgtggacccttgatatcttcagcttcgtttcaaggttcatctttccaaacacctgcatgttctcttaaagatccccttctatcccatacaaaaccta |
3713323 |
T |
 |
| Q |
301 |
catttaatgcaccttctattctaacattacatataactgaacctagacattcatacaaacattgagtctttattcttgttctgcattttatctcaacatg |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3713322 |
catttaatgcaccttctattctaacattacatataactgaacctagacattcatacaaacattgagtctttattattgttctgcattttatctcaacatg |
3713223 |
T |
 |
| Q |
401 |
gcttcacttcctcttcttctgctcctcatcctct |
434 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
3713222 |
gcttctcttcctcttcttctgctcctcatcctct |
3713189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University