View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10274_low_14 (Length: 322)
Name: NF10274_low_14
Description: NF10274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10274_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 66; Significance: 4e-29; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 952341 - 952406
Alignment:
| Q |
1 |
aagaaagagatgaaatgaaacttacagtattcaagtttttccttgcagtctctctactgagtatat |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
952341 |
aagaaagagatgaaatgaaacttacagtattcaagtttttccttgcagtctctctactgagtatat |
952406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 1099597 - 1099532
Alignment:
| Q |
1 |
aagaaagagatgaaatgaaacttacagtattcaagtttttccttgcagtctctctactgagtatat |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1099597 |
aagaaagagatgaaatgaaacttacagtattcaagtttttccttgcagtctctctactgagtatat |
1099532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 90 - 151
Target Start/End: Original strand, 1091066 - 1091130
Alignment:
| Q |
90 |
gactaattaccttagtggttgttacaaga---gaggtgccactgctggtgaagttcgttgagagt |
151 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||| |||| ||||||||| ||| ||||| |
|
|
| T |
1091066 |
gactaattaccttagtagttgttacaagagaggaggtgccgctgccggtgaagtttgttaagagt |
1091130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University