View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10274_low_21 (Length: 270)
Name: NF10274_low_21
Description: NF10274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10274_low_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 26 - 256
Target Start/End: Original strand, 8797121 - 8797351
Alignment:
| Q |
26 |
cttccatggttgttgatgttgtccatgaaatagtaacctaaaccaggagtgttttgatggttattttgaagcatgatagaagaggtgttgttattacagt |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8797121 |
cttccatggttgttgatgttgtccatgaaatagtaacctaaaccaggagtgttttgatggttattttgaagcatgatagaagaggtgttgttattacagt |
8797220 |
T |
|
| Q |
126 |
tggtgtagtgattgttattattgttagtggaattagggataggaaggaaaagaccggttgtgttgtttgcattagtattgttgttattggaatttattgg |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8797221 |
tggtgtagtgattgttattattgttagtggaattagggataggaaggaaaagaccggttgtgttgtttgcattagtattgttgttattggaatttattgg |
8797320 |
T |
|
| Q |
226 |
atgatgagcattatgatgagatgaagtgact |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
8797321 |
atgatgagcattatgatgagatgaagtgact |
8797351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University