View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10274_low_27 (Length: 250)
Name: NF10274_low_27
Description: NF10274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10274_low_27 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 112 - 240
Target Start/End: Complemental strand, 26485872 - 26485744
Alignment:
| Q |
112 |
cactcttcgatcatcctttgatcaaatgggtcctagaagaaagacaacgagcaatgttgtttgcactattggttacttcctcccatatatgatgagccaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26485872 |
cactcttcgatcatcctttgatcaaatgggtcctagaagaaagacaacaagcaatgttgtttgcactattggttacttcctcccatatatgatgagccaa |
26485773 |
T |
|
| Q |
212 |
caactagaaaccagatcgatgtgcctatg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
26485772 |
caactagaaaccagatcgatgtgcctatg |
26485744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 26486029 - 26485986
Alignment:
| Q |
1 |
aattacttcattcgatgatcattgatggtgacaaagattgattt |
44 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
26486029 |
aattacttcattcgatgatcattgatggtgacaaagattcattt |
26485986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University