View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10274_low_32 (Length: 242)
Name: NF10274_low_32
Description: NF10274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10274_low_32 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 59; Significance: 4e-25; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 167 - 240
Target Start/End: Original strand, 1797034 - 1797110
Alignment:
| Q |
167 |
ttaagactcagttatagaccatgccatgtcttcaagactttcaagtat---aaaaatacaaatcttgtctccctttg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
1797034 |
ttaagactcagttatagaccatgccatgtcttcaagactttcaagtataaaaaaaatacaaatcttgtctctctttg |
1797110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 1796863 - 1796913
Alignment:
| Q |
1 |
taaaaatattgaagatttaaaggtgcacgttggtctttgtagttaaacttc |
51 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
1796863 |
taaaaatattgaagatttaaaggtgcacggtggtctttgtagttgaacttc |
1796913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 173 - 242
Target Start/End: Complemental strand, 3528985 - 3528916
Alignment:
| Q |
173 |
ctcagttatagaccatgccatgtcttcaagactttcaagtataaaaatacaaatcttgtctccctttgct |
242 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
3528985 |
ctcagttatagaccatgccatgtcttcaaagctttcaagtataaaaatacaaatcttgcctctctttgct |
3528916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University