View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10274_low_33 (Length: 240)
Name: NF10274_low_33
Description: NF10274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10274_low_33 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 1507960 - 1507736
Alignment:
| Q |
1 |
ttgtgggacatcttactaatttggtttaaattctgttttgacacccctcccc-tagttcaagtgacaacaaacttgaaataagtgagatactttctctca |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1507960 |
ttgtgggacatcttactaatttggtttaaattctgttttgacacccctccccctagttcaagtgacaacaaacttgaaataagtgagatactttctctca |
1507861 |
T |
 |
| Q |
100 |
tttttactctcactatcttaattgaaaattttacagattttnnnnnnnnngctcttattttataattatcaattaattagactactacttttaattgaaa |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1507860 |
tttttactctcactatcttaattgaaaattttacagattaaaaaaaaaaagctcttattttataattatcaattaattagactactacttttaattgaaa |
1507761 |
T |
 |
| Q |
200 |
ataaagtcatccttattagagtatg |
224 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
1507760 |
ataaagtcatccttattagagtatg |
1507736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University