View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10276_low_4 (Length: 262)
Name: NF10276_low_4
Description: NF10276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10276_low_4 |
 |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 30208586 - 30208833
Alignment:
| Q |
1 |
tctacaacatgaaataaaaattaacaaaaagatcatatgatgttaccatctgttgctgttcaatgcattcagaattctccccctcctgagcagcattgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30208586 |
tctacaacatgaaataaaaattaacaaaaagatcatatgatgttaccatctgttgctgttcaatgcattcaggattctccccctcctgagcagcattgat |
30208685 |
T |
 |
| Q |
101 |
ttcatcagtaacaccaacaccggttgccaccttcttcttcctaccacgtttccccttgatcttcttaacttccagctcctcctctacatctgacaagtaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30208686 |
ttcatcagtaacaccaacaccggttgccaccttcttcttcctaccacgtttccccttaatcttcttaacttccagctcctcctctacatctaacaagtaa |
30208785 |
T |
 |
| Q |
201 |
tcctcgttcaatgatctgctactcttcttggcacgctcacttcttctc |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30208786 |
tcctcgttcaatgatctgctactcttcttggcacgctcacttcttctc |
30208833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 160 - 231
Target Start/End: Original strand, 410994 - 411065
Alignment:
| Q |
160 |
tcttcttaacttccagctcctcctctacatctgacaagtaatcctcgttcaatgatctgctactcttcttgg |
231 |
Q |
| |
|
||||||| ||||||| |||||||| |||||||||| |||||| || ||||||||||| ||||||||||||| |
|
|
| T |
410994 |
tcttcttcacttccacttcctcctccacatctgacatgtaatcatccttcaatgatctactactcttcttgg |
411065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University