View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10277_high_7 (Length: 240)
Name: NF10277_high_7
Description: NF10277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10277_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 7353846 - 7354062
Alignment:
| Q |
1 |
ttaagggagaacaacatggagtgctgctacagtacttgtggcgatttcgctgctggattctctcgaagagtggagtgcttatggaggtttttagattcaa |
100 |
Q |
| |
|
||||| ||||||||||||||||| |||| ||||| ||||||||||||||| |||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7353846 |
ttaagtgagaacaacatggagtgttgctgcagtagttgtggcgatttcgccactggattctcacgaagagtggagtacttatggaggtttttagattcaa |
7353945 |
T |
 |
| Q |
101 |
ccagttcgacatttaaaaaccgtgacaacgatgaaaggagaatgatgaaaggtgaggctgcaaaagcatcgacaaaccaacgtgaaacgattgaaaggaa |
200 |
Q |
| |
|
|||||||| |||| ||||||||||||| |||||||||| ||||||| |||| |||||||||||||||| ||||||||| ||||||| | || ||| |
|
|
| T |
7353946 |
ccagttcggcattcaaaaaccgtgacagtgatgaaaggaaaatgatggaaggcgaggctgcaaaagcattgacaaaccagcgtgaaatg-----aacgaa |
7354040 |
T |
 |
| Q |
201 |
aggagagaaaaatggtgtgaaa |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
7354041 |
aggagagaaaaatggtgtgaaa |
7354062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 161 - 222
Target Start/End: Complemental strand, 38549168 - 38549107
Alignment:
| Q |
161 |
caaaagcatcgacaaaccaacgtgaaacgattgaaaggaaaggagagaaaaatggtgtgaaa |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38549168 |
caaaagcatcgacaaaccaacgtgaaacgattgaaaggaaaggagagaaaaatggtgtgaaa |
38549107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University