View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10277_high_8 (Length: 212)

Name: NF10277_high_8
Description: NF10277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10277_high_8
NF10277_high_8
[»] chr3 (1 HSPs)
chr3 (6-42)||(43438073-43438109)


Alignment Details
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 6 - 42
Target Start/End: Original strand, 43438073 - 43438109
Alignment:
6 gagagagatgaagagagtgtgtttagtgatagatcta 42  Q
    |||| ||||||||||||||||||||||||||||||||    
43438073 gagaaagatgaagagagtgtgtttagtgatagatcta 43438109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University