View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10277_low_10 (Length: 212)
Name: NF10277_low_10
Description: NF10277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10277_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 6 - 42
Target Start/End: Original strand, 43438073 - 43438109
Alignment:
| Q |
6 |
gagagagatgaagagagtgtgtttagtgatagatcta |
42 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43438073 |
gagaaagatgaagagagtgtgtttagtgatagatcta |
43438109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University