View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10278_low_11 (Length: 213)
Name: NF10278_low_11
Description: NF10278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10278_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 9 - 197
Target Start/End: Original strand, 34761100 - 34761288
Alignment:
| Q |
9 |
agagagaagaaaaatgcatgcctgaattgtcttcacagcaggcttattgattttcatgaggtgagttctgattcttcttaacttaagcaactctgaacct |
108 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34761100 |
agagaaaagaaaaatgcatgcctgaattgtcttcacagcaggcttattgattttcatgaggtgagttctgattcttcttaacttaagcaactctgaacct |
34761199 |
T |
|
| Q |
109 |
gctttataagtctggttagtcttcgaggggtggatagaatctgagacaatagagtgatgagacaatgctggagtagttgaagtaagaag |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34761200 |
gctttataagtctggttagtcttcgaggggtggatagaatctgagacaatagagtgatgagacaatgctggagtagttgaagtaagaag |
34761288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 25 - 58
Target Start/End: Complemental strand, 29356756 - 29356723
Alignment:
| Q |
25 |
catgcctgaattgtcttcacagcaggcttattga |
58 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
29356756 |
catgcctgaattgtcttaacagcaggcttattga |
29356723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University