View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10278_low_6 (Length: 274)
Name: NF10278_low_6
Description: NF10278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10278_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 46 - 207
Target Start/End: Complemental strand, 17346713 - 17346552
Alignment:
| Q |
46 |
atggtaggattatactattgtatggttgtgaattaagtataattttcaaaacttgttgaagtccctagtgcccgtacaacatattattatttgagcaaca |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17346713 |
atggtaggattatactattgtatggttgtgaattaagtataattttcaaaacttgttgaagtccctagtgcccgtacaacatattattatttgagcaaca |
17346614 |
T |
|
| Q |
146 |
tggaaagtgtattagcctattagacataaactccctccatttcaaaataataatttctttag |
207 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
17346613 |
gggaaagtgtattagcctattaggcataaactccctccatttcaaaataattatttctttag |
17346552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 12 - 58
Target Start/End: Complemental strand, 17346788 - 17346742
Alignment:
| Q |
12 |
catcataaaaaagtataagtaaaatcaatgaaaaatggtaggattat |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
17346788 |
catcataaaaaagtataagtaaaatcaatgaaagatggtaggattat |
17346742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University