View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10278_low_7 (Length: 262)
Name: NF10278_low_7
Description: NF10278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10278_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 33521667 - 33521422
Alignment:
| Q |
1 |
aggaataataacttctgtacacaaagtgctatcagatgaagactcaaaagtaaaatctataattgaaactccttcactaggaccaggagcattttctacc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| ||||||| | |||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
33521667 |
aggaataataacttctgtacacaaagtgctatcagatgatgactctaaagtaagagctataattgaaactccatcactaggaccaggcgcattttctacc |
33521568 |
T |
 |
| Q |
101 |
gtgattccttgggaatccggatttgacttcaatgaaagaatgctaagatattcgaggactgttcatttcatcacaattattcaggacaaaggctgtggag |
200 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33521567 |
atgattccttgggaatccggattcgacttcaaagaaagaatgctaagatattcgaggactgttcatttcatcacaattattcaggacaaaggctgtggag |
33521468 |
T |
 |
| Q |
201 |
aggtgaagagcgagggtaggataaactatgagttagatgaagaatt |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33521467 |
aggtgaagagcgagggtaggataaactatgagttagatgaagaatt |
33521422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University