View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10279_low_10 (Length: 231)
Name: NF10279_low_10
Description: NF10279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10279_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 16 - 164
Target Start/End: Original strand, 36290997 - 36291145
Alignment:
| Q |
16 |
agggagtaatgttttttgtgatgaaatgactgtaggcgtggcgtctatggaatgaagagaaaataatggagcttgtcgatccgtccataagtgattcaac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36290997 |
agggagtaatgttttttgtgatgaaatgactgtaggcgtggcgtctatggaatgaagagaaaataatggagcttgtcgatccgtccataagtgattcaac |
36291096 |
T |
 |
| Q |
116 |
taaaaagagtaaagctttgagatgcatccacatagggatgttatgtgtg |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36291097 |
taaaaagagtaaagctttgagatgcatccacatagggatgttatgtgtg |
36291145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University