View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10279_low_12 (Length: 208)
Name: NF10279_low_12
Description: NF10279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10279_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 75 - 194
Target Start/End: Original strand, 49943477 - 49943596
Alignment:
| Q |
75 |
gtctcagcgtttaatcacagttcttaacctcatccctctctcaatgaatacaatttcagtcgtctcattcacaaaagtcacacagtacctatgcatgaaa |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49943477 |
gtctcagcgtttaatcacagttcttaacctcatccctctctcatgcaatacaatttcagtcgtctcattcacaaaagtcacacagtacctatgcatgaaa |
49943576 |
T |
|
| Q |
175 |
cttcagcaaacaattctgtg |
194 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
49943577 |
cttcagcaaacaattctgtg |
49943596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 17 - 46
Target Start/End: Original strand, 49943419 - 49943448
Alignment:
| Q |
17 |
agttaagattttctcagcttttgtattgtt |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
49943419 |
agttaagattttctcagcttttgtattgtt |
49943448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University