View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10279_low_7 (Length: 240)

Name: NF10279_low_7
Description: NF10279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10279_low_7
NF10279_low_7
[»] chr4 (3 HSPs)
chr4 (1-226)||(51214027-51214252)
chr4 (2-119)||(51200865-51200982)
chr4 (2-131)||(51158071-51158200)
[»] chr3 (1 HSPs)
chr3 (1-226)||(49735858-49736083)
[»] chr7 (1 HSPs)
chr7 (58-112)||(1478353-1478407)
[»] chr6 (1 HSPs)
chr6 (58-112)||(19179973-19180027)


Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 51214027 - 51214252
Alignment:
1 attcacatggaagtaggatggtttgataaagctgagaattcaagtggtgcgctgggtgcaaggctgtcaactgatgctgctttgattcgaactttggttg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||    
51214027 attcacatggaagtaggatggtttgataaagctgagaattcaagtggtgcgcttggtgcaaggctgtcaactgatgctgcttcgattcgaactttggttg 51214126  T
101 gtgacgcactcggtttgcttgttcaagatatctctacagttattacagccttggtaatttcctttcaggcaaattggcagctttctctcatcattcttgt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51214127 gtgacgcactcggtttgcttgttcaagatatctctacagttattacagccttggtaatttcctttcaggcaaattggcagctttctctcatcattcttgt 51214226  T
201 tttgttgcctctactattagtaaatg 226  Q
    ||||||||||||||||||||||||||    
51214227 tttgttgcctctactattagtaaatg 51214252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 2 - 119
Target Start/End: Original strand, 51200865 - 51200982
Alignment:
2 ttcacatggaagtaggatggtttgataaagctgagaattcaagtggtgcgctgggtgcaaggctgtcaactgatgctgctttgattcgaactttggttgg 101  Q
    |||| ||||||||  | ||||||||| |||||||| |||||||||| ||  | || |||||||| || || ||||| ||||   ||||| ||||||||||    
51200865 ttcatatggaagtgagctggtttgatgaagctgagcattcaagtggcgcaattggagcaaggctctctacagatgcagcttcagttcgagctttggttgg 51200964  T
102 tgacgcactcggtttgct 119  Q
    ||| ||||||||||||||    
51200965 tgatgcactcggtttgct 51200982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 2 - 131
Target Start/End: Original strand, 51158071 - 51158200
Alignment:
2 ttcacatggaagtaggatggtttgataaagctgagaattcaagtggtgcgctgggtgcaaggctgtcaactgatgctgctttgattcgaactttggttgg 101  Q
    |||||||||||||| | ||||||||| | |||||| ||||||| || || || || |||||||| || |||||||| ||||   || || || |||||||    
51158071 ttcacatggaagtaagttggtttgatgaggctgagcattcaagcggagcacttggagcaaggctctccactgatgcagcttcagttagagctctggttgg 51158170  T
102 tgacgcactcggtttgcttgttcaagatat 131  Q
     || ||||| |||||||| |||||| ||||    
51158171 ggatgcacttggtttgctggttcaaaatat 51158200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 49736083 - 49735858
Alignment:
1 attcacatggaagtaggatggtttgataaagctgagaattcaagtggtgcgctgggtgcaaggctgtcaactgatgctgctttgattcgaactttggttg 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| |||||||||| |||||||||||||||||    
49736083 attcacatggaagtaggatggtttgataaagctgagaattcaagtggtgcacttggtgcaaggctgtcaaccgatgctgcttcgattcgaactttggttg 49735984  T
101 gtgacgcactcggtttgcttgttcaagatatctctacagttattacagccttggtaatttcctttcaggcaaattggcagctttctctcatcattcttgt 200  Q
    | || |||||||||||||| |||||||||||  | || || ||||||||||||||||||  |||| || | |  ||||||||||||||||||||||||||    
49735983 gggatgcactcggtttgctagttcaagatattgccactgtaattacagccttggtaattggctttgagactagctggcagctttctctcatcattcttgt 49735884  T
201 tttgttgcctctactattagtaaatg 226  Q
    |||| | |||||||| ||||||||||    
49735883 tttgctacctctactgttagtaaatg 49735858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 58 - 112
Target Start/End: Original strand, 1478353 - 1478407
Alignment:
58 gcaaggctgtcaactgatgctgctttgattcgaactttggttggtgacgcactcg 112  Q
    ||||||||||| |||||||| |||||||||||| | |||| |||||| |||||||    
1478353 gcaaggctgtctactgatgcagctttgattcgagcgttggatggtgatgcactcg 1478407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 58 - 112
Target Start/End: Original strand, 19179973 - 19180027
Alignment:
58 gcaaggctgtcaactgatgctgctttgattcgaactttggttggtgacgcactcg 112  Q
    ||||||||||| |||||||| |||||||||||| | |||| |||||| |||||||    
19179973 gcaaggctgtctactgatgcagctttgattcgagcgttggatggtgatgcactcg 19180027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University