View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10280_high_3 (Length: 339)
Name: NF10280_high_3
Description: NF10280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10280_high_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 6e-59; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 201 - 328
Target Start/End: Complemental strand, 9075243 - 9075116
Alignment:
| Q |
201 |
tttaatcgaattccaacccgtttgaatcttgctcataggaatgtgcttcctcctaatgataatttgagttgtgtgctttgtgatttggaggtagaatcaa |
300 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9075243 |
tttaatcgaattccaacccgttcgaatcttgctcataggaatgtgcttcctcctaatgataatttgagttgtgtgctttgtgatttggaggtagaatcaa |
9075144 |
T |
|
| Q |
301 |
aaaaccatttatttgtgcattgtgatgt |
328 |
Q |
| |
|
||||||||| ||||||||||||||||| |
|
|
| T |
9075143 |
caaaccatttgtttgtgcattgtgatgt |
9075116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 78 - 230
Target Start/End: Complemental strand, 47337469 - 47337317
Alignment:
| Q |
78 |
aagaagttggaggtgttggcaggaatggggaatgattggggggtagaggagaaaacagtgtttggccaaatatggaagagcccggctccttccatagtgg |
177 |
Q |
| |
|
|||||| | |||||| |||| || || | |||||| |||||| ||||||||||| || ||| ||||| | |||||||||||||||||||| | |||| |
|
|
| T |
47337469 |
aagaagctagaggtggtggcgggtattgagaatgagtgggggttagaggagaaacatgtctttagccaagtttggaagagcccggctccttctaaggtgg |
47337370 |
T |
|
| Q |
178 |
tggtgctttcttggaagtctctttttaatcgaattccaacccgtttgaatctt |
230 |
Q |
| |
|
||| ||| ||||||| ||| | ||||||| || || ||||||||||||||| |
|
|
| T |
47337369 |
tggcgctctcttggagatctttgcttaatcgtataccgacccgtttgaatctt |
47337317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University