View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10281_high_13 (Length: 284)
Name: NF10281_high_13
Description: NF10281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10281_high_13 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 270
Target Start/End: Complemental strand, 30576210 - 30575941
Alignment:
| Q |
1 |
tggttctttcttcaatataattgttctccttcctctgtattatctcccgtcgatattatggaagaaaccaaccactacgacaacaaagtcattcattctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30576210 |
tggttctttcttcaatataattgttctccttcctctgtattatctcccgtcgatattatggaagaaaccaaccactacgacaacaaagtcattcattctc |
30576111 |
T |
|
| Q |
101 |
ggcaagcacagattcggaccagatctgtatgtcgtggttgggaaagtttttcctttcatatgactctatcaaaaatgtacaatgtggttgaactttctgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30576110 |
ggcaagcacagattcggaccagatctgtatgtcgcagttgggaaagtttttcctttcatatggctctatcaaaaatgtacaatgcggttgaactttctgc |
30576011 |
T |
|
| Q |
201 |
tcttggaattggtagttgtttttgctcaacatttatatgaatttcaggtatatttttcactcgattgctc |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30576010 |
tcttggaattggtagttgtttttgctcaacatttttatgaatttcaggtatatttttcactcgattgctc |
30575941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University