View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10281_high_15 (Length: 251)
Name: NF10281_high_15
Description: NF10281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10281_high_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 16 - 233
Target Start/End: Complemental strand, 25742844 - 25742629
Alignment:
| Q |
16 |
aaaggccaagttgaatgaaaaggaacttcttgaaaagttacttttggaatggagtgagaatgctgatactgacaattcacaacaagaaaaagacatacta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25742844 |
aaaggccaagttgaatgaaaaggaacttcttgaaaagttaattttggaatggggtgagaatgctgatactgacaattcacaacaagaaaaagacatacta |
25742745 |
T |
|
| Q |
116 |
gacaggttacagccccatacaaatattaaagagctttctatacataactacctagggacggaatttcctagttgggtcggagactcttccttctacaact |
215 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
25742744 |
gacaggttacagccccatacaaatctt--agagctttctatacataactacctagggacagaatttcctaattgggtcggagactcttccttctacaact |
25742647 |
T |
|
| Q |
216 |
tgttgttcatggagctcc |
233 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
25742646 |
tgttgttcatggagctcc |
25742629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University