View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10281_low_14 (Length: 337)
Name: NF10281_low_14
Description: NF10281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10281_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 300; Significance: 1e-169; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 300; E-Value: 1e-169
Query Start/End: Original strand, 19 - 326
Target Start/End: Complemental strand, 25177404 - 25177097
Alignment:
| Q |
19 |
ggaggtgctagagaatcttgcatttctagcaaatgcaagcaacttggtgttatatctaaggaaatatatgcacttttcaccatcaaaatctgctaacaat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25177404 |
ggaggtgctagagaatcttgcatttctagcaaatgcaagcaacttggtgttatatctaaggaaatatatgcacttttcaccatcaaaatctgctaacaat |
25177305 |
T |
|
| Q |
119 |
gtgacaaatttcatgggaacagcttttcttcttgctttgcttggtggttttttatctgatgcatttttcacaacttatcacatatacctgataagtgcag |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
25177304 |
gtgacaaatttcatgggaacagcttttcttcttgctttgcttggtggttttttatctgatgcatttttcacaacttatcacatctacctgataagtgcag |
25177205 |
T |
|
| Q |
219 |
ttattgagttcctggtatgaaccttacttcacacttttcctcatctctctttttctatgtgtgggatcacatgtgaatttcatgacacttcgagttttgg |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25177204 |
ttattgagttcctggtatgaaccttacttcacacttttcctcatctctctttttctatgtgtgggatcacatgtgaatttcatgacacttcgagttttga |
25177105 |
T |
|
| Q |
319 |
tgtttcat |
326 |
Q |
| |
|
|||||||| |
|
|
| T |
25177104 |
tgtttcat |
25177097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 54; Significance: 6e-22; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 104 - 225
Target Start/End: Original strand, 16825297 - 16825418
Alignment:
| Q |
104 |
aaatctgctaacaatgtgacaaatttcatgggaacagcttttcttcttgctttgcttggtggttttttatctgatgcatttttcacaacttatcacatat |
203 |
Q |
| |
|
||||| || |||||||| |||||||| ||||||||| | ||||| |||||| | ||||||||||| || |||||||||||| |||| |||||||| | | |
|
|
| T |
16825297 |
aaatcagccaacaatgtcacaaattttatgggaacatcatttctacttgctctacttggtggtttcttgtctgatgcatttctcaccacttatcatgtct |
16825396 |
T |
|
| Q |
204 |
acctgataagtgcagttattga |
225 |
Q |
| |
|
|| ||||||||||||||||||| |
|
|
| T |
16825397 |
acttgataagtgcagttattga |
16825418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 85 - 196
Target Start/End: Original strand, 44610143 - 44610254
Alignment:
| Q |
85 |
tatgcacttttcaccatcaaaatctgctaacaatgtgacaaatttcatgggaacagcttttcttcttgctttgcttggtggttttttatctgatgcattt |
184 |
Q |
| |
|
||||||||||||||| || | ||||| |||| ||| || || ||||||||||||||||| || |||||| | |||||||| ||| | | ||||| ||| |
|
|
| T |
44610143 |
tatgcacttttcaccttctacctctgccaacattgtcaccaacttcatgggaacagctttcctacttgctattcttggtggatttcttgcagatgctttt |
44610242 |
T |
|
| Q |
185 |
ttcacaacttat |
196 |
Q |
| |
|
||||| |||||| |
|
|
| T |
44610243 |
ttcactacttat |
44610254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University