View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10281_low_20 (Length: 266)
Name: NF10281_low_20
Description: NF10281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10281_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 19 - 261
Target Start/End: Original strand, 42376712 - 42376960
Alignment:
| Q |
19 |
cataaataattaagggatggaaaaactttcccctaatatcaatggtcacttcaaaatccatagttctgaacacggttctaaattgtggtccgcaa----- |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42376712 |
cataaataattaagggatggaaaaactttcccctaatatcaatggtcacttcaaaatccatagttctgaacacggttctaaattgtggtccgcaattgca |
42376811 |
T |
 |
| Q |
114 |
-ctgcaactgcagtctcattacacaaatatcgattagcaaacaaatgaagctagagaatcttgaagtgcaacacacaaaaatttctccaagtctggtgtt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42376812 |
actgcaactgcagtctcattacacaaatatcgactagcaaacaaatgaagctagagaatcttgaagtgcaacacacaaaaatttctccaagtctggtgtt |
42376911 |
T |
 |
| Q |
213 |
gcgaaaaatgatcgacgaagagagaaatttgaaagcaccctttgcttct |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42376912 |
gcgaaaaatgatcgacgaagagagaaatttgaaagcaccctttgtttct |
42376960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University