View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10281_low_21 (Length: 255)
Name: NF10281_low_21
Description: NF10281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10281_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 4 - 242
Target Start/End: Original strand, 25742895 - 25743128
Alignment:
| Q |
4 |
ttcatcaatggaagatccatattcttttcctatgaaaaagtcacttagtttttgtaggtttgtcaatgcacataaatgcaatggcatccatttcaaactc |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25742895 |
ttcatcaatggaagatccatattcttttcctatgaaaaagtcacttagtttttgtaggtttgtcaatgcacataaatgcaatggcatccatttcaaactc |
25742994 |
T |
 |
| Q |
104 |
gtacaagtaatatctaagtaacgcaggttaactaacctatgaaaatctttaggaagttcttgtaggttagtacatccaactagtttcaaagtttccaaat |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
25742995 |
gtacaagtaatatctaagtaacgcaggttaactaacctatgaaaatctttagga-----ttgtaggttagtacatccaactagcttcaaagtttccaaat |
25743089 |
T |
 |
| Q |
204 |
tgtacagacaaccaatgctttcccgcaatatgttcatct |
242 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
25743090 |
tgtacagacaaccgatgctttcccgcaatatgttcatct |
25743128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University