View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10281_low_23 (Length: 243)

Name: NF10281_low_23
Description: NF10281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10281_low_23
NF10281_low_23
[»] chr1 (1 HSPs)
chr1 (1-224)||(5439468-5439704)


Alignment Details
Target: chr1 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 5439704 - 5439468
Alignment:
1 aatctatctaatataaatttcaattatgctgcgaannnnnnngtgcaaattgaaaaatatggagtaaacttttaaaaccacaactatgcacacacnnnnn 100  Q
    ||||||||||||||||||||||||||||| |||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||         
5439704 aatctatctaatataaatttcaattatgcggcgaatttttttgtgcaaattgaaaaatatggagtaaacttttaaaaccacaactatgcacacacaaaaa 5439605  T
101 nn-------------catgcaaaatgccataggtataccctcgatgtgttaaaatgaacttgaacnnnnnnntaaaatcatatcacgttgatattatgga 187  Q
                   ||||||||||| ||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||    
5439604 aaaaacaaaaaaaaacatgcaaaatgtcataggtataccctcgatgtgttaaaatgaacttgaacaaaaaaataaaatcatatcacgttgatattatgga 5439505  T
188 ctaaaacttcaccatttactttttaggtataccctcg 224  Q
    |||||||||||||||||||||||||||||||||||||    
5439504 ctaaaacttcaccatttactttttaggtataccctcg 5439468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University