View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10281_low_25 (Length: 236)
Name: NF10281_low_25
Description: NF10281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10281_low_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 42376956 - 42377178
Alignment:
| Q |
1 |
tttctttggtgctggtggacatgtggaaatttctggtatccgaaattttttaccttttggcgttgagcataaactgttacttgtgatggagacatcatca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42376956 |
tttctttggtgctggtggacatgtggaaatttctggtatccgaaattttttaccttttggcgttgagcataaactgttacttgtgatggagacatcatca |
42377055 |
T |
 |
| Q |
101 |
acaaccttaacagaatccatgtttgaggaacaattttcagaggatgtttcttgttgtttgctttgtagatgctgattcttgatgttgcttcttgtgagtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42377056 |
acaaccttaacagaatccatgtttgaggaacaattttcagaggatgtttcttgttgtttgctttgtagatgctgattcttgatgttgcttcttgtgagtt |
42377155 |
T |
 |
| Q |
201 |
ttcttcctcttgttcttgtcttc |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
42377156 |
ttcttcctcttgttcttgtcttc |
42377178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 79
Target Start/End: Original strand, 24578848 - 24578926
Alignment:
| Q |
1 |
tttctttggtgctggtggacatgtggaaatttctggtatccgaaattttttaccttttggcgttgagcataaactgtta |
79 |
Q |
| |
|
||||||||||||||| |||||||| ||||| |||||||||| | |||| | ||||||||| ||||| ||| ||||||| |
|
|
| T |
24578848 |
tttctttggtgctggaggacatgttgaaatctctggtatcctatatttctgaccttttggtgttgaacatgcactgtta |
24578926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University