View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10281_low_26 (Length: 223)
Name: NF10281_low_26
Description: NF10281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10281_low_26 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 130481 - 130274
Alignment:
| Q |
1 |
aagtatgaatgaatgaaatagcagaggtaggtacctctccatcagatccgcgtacagtaagacggtatacaacagttacagttccattatcggagaaaat |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
130481 |
aagtatgaatgaatgcaatagcagaggtaggtacctctccatcagatccgcgtacagtaagacggtatacaacagttacagttccattatcggagaaaat |
130382 |
T |
|
| Q |
101 |
aacatcacgtatctctccacaccatcctac--nnnnnnnnnnnnncagatttcaaattcaaaactattgttttaatttaatcctaacctatccacctaaa |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| |||||||| |||||||| ||| |
|
|
| T |
130381 |
aacatcacgtatctctccacaccatcctacaaaaaagtaaaaaaacagatttcaaattgaaaactattgttttaatttgatcctaacatatccaccaaaa |
130282 |
T |
|
| Q |
199 |
ttcaaaaa |
206 |
Q |
| |
|
|| ||||| |
|
|
| T |
130281 |
ttaaaaaa |
130274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University