View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10282_high_9 (Length: 280)
Name: NF10282_high_9
Description: NF10282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10282_high_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 4e-75; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 18 - 164
Target Start/End: Complemental strand, 10586369 - 10586223
Alignment:
| Q |
18 |
ctttgttaatgtatgttctctctttacctttcttataccataaaaattcaatattttcaatcagttgttttttagatttatgtatatctttttaatcgct |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10586369 |
ctttgttaatgtatgttctctctttacctttcttataccatcaaaattcaatattttcaatcagttgttttttagatttatgtatatctttttaatcgct |
10586270 |
T |
|
| Q |
118 |
acaaatattttgtcacataattgcaataaatatttttagttagacat |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10586269 |
acaaatattttgtcacataattgcaataaatatttttagttagacat |
10586223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 221 - 275
Target Start/End: Original strand, 10499578 - 10499632
Alignment:
| Q |
221 |
ctttggttgaatgagttgttgaatttgtgaaggggtgtgatggttctgtgctgct |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
10499578 |
ctttggttgaatgagttgttgaatttgtgaaggggtgtgatggttctgtgttgct |
10499632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 221 - 275
Target Start/End: Complemental strand, 10586176 - 10586122
Alignment:
| Q |
221 |
ctttggttgaatgagttgttgaatttgtgaaggggtgtgatggttctgtgctgct |
275 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||||||||||||| |||| |
|
|
| T |
10586176 |
ctttggttgaatgagttgattaatttgtgaaggggtgtgatggttctgtgttgct |
10586122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University