View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10282_low_14 (Length: 280)

Name: NF10282_low_14
Description: NF10282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10282_low_14
NF10282_low_14
[»] chr4 (3 HSPs)
chr4 (18-164)||(10586223-10586369)
chr4 (221-275)||(10499578-10499632)
chr4 (221-275)||(10586122-10586176)


Alignment Details
Target: chr4 (Bit Score: 143; Significance: 4e-75; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 18 - 164
Target Start/End: Complemental strand, 10586369 - 10586223
Alignment:
18 ctttgttaatgtatgttctctctttacctttcttataccataaaaattcaatattttcaatcagttgttttttagatttatgtatatctttttaatcgct 117  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10586369 ctttgttaatgtatgttctctctttacctttcttataccatcaaaattcaatattttcaatcagttgttttttagatttatgtatatctttttaatcgct 10586270  T
118 acaaatattttgtcacataattgcaataaatatttttagttagacat 164  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
10586269 acaaatattttgtcacataattgcaataaatatttttagttagacat 10586223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 221 - 275
Target Start/End: Original strand, 10499578 - 10499632
Alignment:
221 ctttggttgaatgagttgttgaatttgtgaaggggtgtgatggttctgtgctgct 275  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
10499578 ctttggttgaatgagttgttgaatttgtgaaggggtgtgatggttctgtgttgct 10499632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 221 - 275
Target Start/End: Complemental strand, 10586176 - 10586122
Alignment:
221 ctttggttgaatgagttgttgaatttgtgaaggggtgtgatggttctgtgctgct 275  Q
    |||||||||||||||||| | ||||||||||||||||||||||||||||| ||||    
10586176 ctttggttgaatgagttgattaatttgtgaaggggtgtgatggttctgtgttgct 10586122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University