View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10282_low_16 (Length: 265)

Name: NF10282_low_16
Description: NF10282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10282_low_16
NF10282_low_16
[»] chr4 (3 HSPs)
chr4 (23-258)||(52760731-52760966)
chr4 (61-165)||(52796883-52796987)
chr4 (62-170)||(52798774-52798882)
[»] chr2 (1 HSPs)
chr2 (83-170)||(38710644-38710731)
[»] chr3 (1 HSPs)
chr3 (102-170)||(42094276-42094344)


Alignment Details
Target: chr4 (Bit Score: 236; Significance: 1e-130; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 23 - 258
Target Start/End: Complemental strand, 52760966 - 52760731
Alignment:
23 caccgctcatgcttcggcgccaagtgttactaaaacgcatgctccagcaccaagtcctcatcattctggttctgcgagattgagtggttatgttggtatc 122  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52760966 caccgctcatgcttcggcgccaagtgttactaaaacgcatgctccagcaccaagtcctcatcattctggttctgcgagattgagtggttatgttggtatc 52760867  T
123 aatgttgtggtggctttggtcttaggaagctttgttttttagaatgttggtagtttacatgcatctaaacatcgttgcttttatttcctgtctttatgtt 222  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52760866 aatgttgtggtggctttggtcttaggaagctttgttttttagaatgttggtagtttacatgcatctaaacatcgttgcttttatttcctgtctttatgtt 52760767  T
223 gttgaatttcgtcgtactctagtttagtctctgctt 258  Q
    ||||||||||||||||||||||||||||||||||||    
52760766 gttgaatttcgtcgtactctagtttagtctctgctt 52760731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 61 - 165
Target Start/End: Original strand, 52796883 - 52796987
Alignment:
61 atgctccagcaccaagtcctcatcattctggttctgcgagattgagtggttatgttggtatcaatgttgtggtggctttggtcttaggaagctttgtttt 160  Q
    |||||||  ||||||||||| ||| ||| |||||||||||  ||||||| | ||||||  ||| ||||||||||||||| |||||||||||||||| | |    
52796883 atgctccttcaccaagtcctaatcgttcgggttctgcgaggatgagtgggtctgttggggtcagtgttgtggtggcttttgtcttaggaagctttgctat 52796982  T
161 ttaga 165  Q
    |||||    
52796983 ttaga 52796987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 62 - 170
Target Start/End: Original strand, 52798774 - 52798882
Alignment:
62 tgctccagcaccaagtcctcatcattctggttctgcgagattgagtggttatgttggtatcaatgttgtggtggctttggtcttaggaagctttgttttt 161  Q
    |||||| || || |||||| | ||||| |||||| | || |||||||||| || |||| | | |||||||||||||||||||||||||| ||||| ||||    
52798774 tgctccggcgcctagtcctaaacattcgggttctaccaggttgagtggttctgatggtgttagtgttgtggtggctttggtcttaggaacctttgctttt 52798873  T
162 tagaatgtt 170  Q
    |||||||||    
52798874 tagaatgtt 52798882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 52; Significance: 7e-21; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 83 - 170
Target Start/End: Complemental strand, 38710731 - 38710644
Alignment:
83 tcattctggttctgcgagattgagtggttatgttggtatcaatgttgtggtggctttggtcttaggaagctttgttttttagaatgtt 170  Q
    |||||| ||||||  ||| |||||||||| ||||||| | | |||||||||||||||||||||||||||||||| |||||||||||||    
38710731 tcattcgggttctaggaggttgagtggttttgttggtgtgagtgttgtggtggctttggtcttaggaagctttgctttttagaatgtt 38710644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 102 - 170
Target Start/End: Complemental strand, 42094344 - 42094276
Alignment:
102 ttgagtggttatgttggtatcaatgttgtggtggctttggtcttaggaagctttgttttttagaatgtt 170  Q
    |||||||||| ||||||| |||||||||||||||| ||||| ||||||||| ||| |||||||||||||    
42094344 ttgagtggttctgttggtgtcaatgttgtggtggcattggtattaggaagccttgctttttagaatgtt 42094276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University