View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10282_low_19 (Length: 248)
Name: NF10282_low_19
Description: NF10282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10282_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 30360808 - 30361039
Alignment:
| Q |
1 |
aggggtttacggaccttctctggaactgggattgggtccctgcaaggtacattcagatgaaaagaaatttaggctcactacttgtatcatcattgaaaat |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30360808 |
aggggtttgcggaccttctctggaactgggattgggtccctgcaaggtacattcagatgaaaagaaatttaggctcactacttgtatcatcattgaaaat |
30360907 |
T |
|
| Q |
101 |
atgcatgcttcgaaaagnnnnnnnngtcctggttgttaaaatttctttggaagaaaatacgcatgcttnnnnnnngtcttgattgctcactcttttaata |
200 |
Q |
| |
|
||||||||||||||| | |||||||||||| |||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30360908 |
atgcatgcttcgaaatgaaaaaaaagtcctggttgtttaaatttcttttgaagaaaatacgcatgcttaaaaaaagtcttgattgctcactcttttaata |
30361007 |
T |
|
| Q |
201 |
ctggttgcgccttaaattttctcatctgtgct |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
30361008 |
ctggttgcgccttaaattttctcatctgtgct |
30361039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 1 - 115
Target Start/End: Original strand, 19916207 - 19916321
Alignment:
| Q |
1 |
aggggtttacggaccttctctggaactgggattgggtccctgcaaggtacattcagatgaaaagaaatttaggctcactacttgtatcatcattgaaaat |
100 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19916207 |
aggggtttgcggaccttctctggaactgggattgggtccctgcaaggtacattcatatgaaaagaaatttaggctcactacttgtatcatcattgaaaat |
19916306 |
T |
|
| Q |
101 |
atgcatgcttcgaaa |
115 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
19916307 |
atgcatgcttcgaaa |
19916321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University