View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10282_low_2 (Length: 412)
Name: NF10282_low_2
Description: NF10282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10282_low_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 389; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 389; E-Value: 0
Query Start/End: Original strand, 1 - 397
Target Start/End: Complemental strand, 12934555 - 12934159
Alignment:
| Q |
1 |
aaagaagaagacgcaacaagaacaagaagggcttccccacaccatcctctcccgacaaacaaaaaacgagcccattcctgttccttcaccaccgaacaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12934555 |
aaagaagaagacgcaacaagaacaagaagggcttccccacaccatcctctcccgacaaacaaaaaacgagcccattcctgttccttcaccaccgaacaca |
12934456 |
T |
 |
| Q |
101 |
acaccacctctctctatcctacaccttttttcttaacctacaccccctctttttacccataacacccacatcatttctcatcgatcttcaccacaatcat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12934455 |
acaccacctctctctatcctacaccttttttcttaacctacaccccctctttttacccataacacccacatcatttctcatcgatcttcaccacaatcat |
12934356 |
T |
 |
| Q |
201 |
tttagggttagggtttctgagagatgtgggatgcttcagtcattgatgaatcttctctctccatgttggaagccgttcgggcacggtggtgacgattctt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12934355 |
tttagggttagggtttctgagagatgtgggatgcttcagtcattgatgaatcttctctctccatgttggaagccgttcgggcacggtggtgacgattctt |
12934256 |
T |
 |
| Q |
301 |
catccgccgctgttggaagagaaggaaaagacggattgctttggtttcgtgatatcggaaaatatggctccggtgaattctctatggctgttgttca |
397 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12934255 |
catccgccgttgttggaagagaagggaaagacggattgctttggtttcgtgatatcggaaaatatggctccggtgaattctctatggctgttgttca |
12934159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University