View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10282_low_21 (Length: 242)
Name: NF10282_low_21
Description: NF10282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10282_low_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 113 - 225
Target Start/End: Complemental strand, 5024759 - 5024647
Alignment:
| Q |
113 |
atgatattattagtagttcaaaagtttgttagtatatatagaagttctattttccaaagcatatctagtttgaagatgtgtgttcaaagaaccctaattc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5024759 |
atgatattattagtagttcaaaagtttgttcgtatctatagaagttctattttccaaagcatatctagtttgaagatgtgtgttcaaagaaccctaattc |
5024660 |
T |
|
| Q |
213 |
tcgcattgatttc |
225 |
Q |
| |
|
||||||||||||| |
|
|
| T |
5024659 |
tcgcattgatttc |
5024647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 30
Target Start/End: Complemental strand, 5024872 - 5024843
Alignment:
| Q |
1 |
ttattgttttgtcctgttaaatctcaatta |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
5024872 |
ttattgttttgtcctgttaaatctcaatta |
5024843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University