View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10282_low_3 (Length: 399)
Name: NF10282_low_3
Description: NF10282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10282_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 18 - 391
Target Start/End: Complemental strand, 52443984 - 52443605
Alignment:
| Q |
18 |
atactattctaatcactattatcctaaatgcatgcgagtatatattgatttaacaatgatgaaactagtataaattagatggtagaattgnnnnnnnnta |
117 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
52443984 |
atactattctaatcactattaccctaaatgtatgtgagtatatattgatttaacaatgatgaaactagtataaattagatggtagaattgaaagaaaaaa |
52443885 |
T |
|
| Q |
118 |
a------gtaattatgggtgatggtgattatgctgggttctttttcaatttggattcaattagctggcttaagttgggtttgtctggcatcaccagtatt |
211 |
Q |
| |
|
| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
52443884 |
aaaagaagtaattatgggtaatggtgattatgctgggttctttttcaatttggattcaattagctggcttaagtggggtttgtctaacatcaccagtatt |
52443785 |
T |
|
| Q |
212 |
tctgactacattggtaacaatgattatgttgagttatttgaaaaaattcaatatttttgcaacaggcatttagtgggcttggcgtaatcgtaattcttct |
311 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
52443784 |
tctgactacattggtaacggtgattatgttgagttatttgaaaaaattcagtatttttgcaacaggcatttagtgggcttggcgtaatcgcaattcttct |
52443685 |
T |
|
| Q |
312 |
agcatcaccaatgtagcaatcccacaataccaccttatgatcgaaccccataatacgacttctacattcatccctttgct |
391 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||| ||||| ||||| |
|
|
| T |
52443684 |
agcatcaccaatgtagcaatcccataataccaccttatgatcgaaccccataatacgacttatacatttatccccttgct |
52443605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University