View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10283_high_3 (Length: 367)
Name: NF10283_high_3
Description: NF10283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10283_high_3 |
 |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0007 (Bit Score: 324; Significance: 0; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 18 - 357
Target Start/End: Complemental strand, 250350 - 250011
Alignment:
| Q |
18 |
cttgatacttctccaaggaaaacatctcttctttttcttcttgctcaaacaacctccacctatatttatttcccaatcacaattgttgcggccgtctcgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
250350 |
cttgatacttctccaaggaaaacatctcttctttttcttcttgctcaaacaacctccacctatatttatttcccaatcacaattgttgcggccgtctcgg |
250251 |
T |
 |
| Q |
118 |
tcttcatcatatacgttaagataatgacggcgagggtcgctaggccatctaaagctgcagaagaataacgtagttttaaaaataatcactgatggtttaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| ||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
250250 |
tcttcatcatatacgttaagataatgacggcgatggtcactaggccatgtaaagctgcagaagaataacgtagttttaaaaataatcacagatggtttaa |
250151 |
T |
 |
| Q |
218 |
atgaaaatgtgtaacttcctccgtattggacattgtgaactttaagatcgttatctctagattggcaacgtaatatgaaaaatggtgccggtaattgatt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
250150 |
atgaaaatgtgtaacttcctccgtattggacattgtgaactttaagatcgttatctctagattggcaacgtaatatgaaaaatggtgccggtaattgatt |
250051 |
T |
 |
| Q |
318 |
gataattgtaactgttactctaacagctatagtctctgtg |
357 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
250050 |
gataattgtaactgttactctaacagctatagtctctgtg |
250011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University