View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10283_low_11 (Length: 257)
Name: NF10283_low_11
Description: NF10283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10283_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 149; Significance: 8e-79; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 39 - 249
Target Start/End: Original strand, 25690409 - 25690619
Alignment:
| Q |
39 |
gaaccgcatattcataggctttgaatagacatgagaaattttagaataattcggattgtatttgtcgaaatttggtttggattataattgtcgagcaaat |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
25690409 |
gaaccgcatattcataggctttgaatagacatgagaaattttaaaataattcggattgtatttgtcgaaatttggttcggattataattgttgagcaaat |
25690508 |
T |
 |
| Q |
139 |
gatatttttgaaagnnnnnnntagggtgcatgagtaacacaggggggaaaaaacaatagccttnnnnnnntgttgttctttctctttcagtcgactctca |
238 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| |||||||||| |
|
|
| T |
25690509 |
gatatttttgaaagaaaaaaatagggtgcatgagtaacacaggggggaaaaaacaatagccttaaaaaaatgtcgttctttctctttcactcgactctca |
25690608 |
T |
 |
| Q |
239 |
tttttcttctc |
249 |
Q |
| |
|
||||||||||| |
|
|
| T |
25690609 |
tttttcttctc |
25690619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 38 - 101
Target Start/End: Complemental strand, 25689587 - 25689524
Alignment:
| Q |
38 |
cgaaccgcatattcataggctttgaatagacatgagaaattttagaataattcggattgtattt |
101 |
Q |
| |
|
||||| ||||||| | | |||||||||||||||||| |||||||||| | |||||||||||||| |
|
|
| T |
25689587 |
cgaactgcatatttacaagctttgaatagacatgagcaattttagaacagttcggattgtattt |
25689524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 44 - 84
Target Start/End: Complemental strand, 5588413 - 5588373
Alignment:
| Q |
44 |
gcatattcataggctttgaatagacatgagaaattttagaa |
84 |
Q |
| |
|
|||||||||||||||||||||| | ||||| |||||||||| |
|
|
| T |
5588413 |
gcatattcataggctttgaataaatatgagcaattttagaa |
5588373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University