View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10283_low_7 (Length: 340)
Name: NF10283_low_7
Description: NF10283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10283_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 23 - 321
Target Start/End: Complemental strand, 47475589 - 47475292
Alignment:
| Q |
23 |
gtataaatcttctctctttgaacattggctaggtcatgatcatgcggcaatattcataatatctatgaaacttctaaaaactggctccaactacagtcga |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| ||||||||||| |
|
|
| T |
47475589 |
gtataaatcttctctctttgaacattggctaggtcatgatcatgcggcaatattcataatatctattaa-cttctaaaaactggctcccactacagtcga |
47475491 |
T |
 |
| Q |
123 |
agtcataacactaaactattgccacaaagtgaaaataccaccgggtcaacttggatttgaatctagtttggacttctttttgaaattcttttcatagata |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47475490 |
agtcataacactaaactattgccacaaagtgaaaataccaccgggtcaacttggatttgaatctagtttggacttctttttgaaattcttttcatagata |
47475391 |
T |
 |
| Q |
223 |
ttgcccctttgtgatatcattccaaaggacatgatactaaaatctcatgcgatgtgttgattacttgcttccttattctttactcttttttgtattctc |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47475390 |
ttgcccctttgtgatatcattccaaaggacatgatactaaaatctcatgcgatgtgttgattacttgcttccttattctttactcttttttgtattctc |
47475292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University