View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10284_low_11 (Length: 261)
Name: NF10284_low_11
Description: NF10284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10284_low_11 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 7 - 251
Target Start/End: Original strand, 32465813 - 32466057
Alignment:
| Q |
7 |
gttttttcttattttgttgctcatttcaaggcacatattgttgagaggtctgatgtggataatcttcagtttcgtacattgacttttatggaaggggtga |
106 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32465813 |
gttttttcttattttgttgctcatttcaaagcacatattgttgagaggcctgatgtggataatcttcagtttcgtacattgactcttatggaaggggtga |
32465912 |
T |
|
| Q |
107 |
atttgattaaaccttttcgtatggaggatgggaaagctgcagtttgggattgtgaaaattataagagtcctggtctggatgacatcatttttgattttat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32465913 |
atttgattaaaccttttcgtatggaggatgggaaagctgcagtttgggattgtgaaaattataagagtcctggtctggatgacatcattttttattttat |
32466012 |
T |
|
| Q |
207 |
taaagaactttggaatgaaatcaaacacgacattatgaaattcat |
251 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32466013 |
taaagaattttggaatgaaatcaaatacgacattatgaaattcat |
32466057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 146 - 225
Target Start/End: Original strand, 21139648 - 21139727
Alignment:
| Q |
146 |
cagtttgggattgtgaaaattataagagtcctggtctggatgacatcatttttgattttattaaagaactttggaatgaa |
225 |
Q |
| |
|
|||||||||||||||| | || ||||||| |||| | | |||| |||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
21139648 |
cagtttgggattgtgatagttttaagagttctgggccgtatgagatcagttttgatttcattaaagaactttggaatgaa |
21139727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 115 - 181
Target Start/End: Original strand, 18919659 - 18919725
Alignment:
| Q |
115 |
aaaccttttcgtatggaggatgggaaagctgcagtttgggattgtgaaaattataagagtcctggtc |
181 |
Q |
| |
|
||||||||| ||||||||| | ||| ||||||||||||| ||||| | ||||||||||||||||| |
|
|
| T |
18919659 |
aaacctttttctatggaggaagtcaaatctgcagtttgggactgtgatagttataagagtcctggtc |
18919725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University