View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10284_low_15 (Length: 241)
Name: NF10284_low_15
Description: NF10284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10284_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 3 - 225
Target Start/End: Original strand, 44144459 - 44144681
Alignment:
| Q |
3 |
atttgcttagagcactacagttgtcaatgaaacatggataaatttaaaattagggaaggtctcgagatttttgtcaagctgaatatgaaattcaataaag |
102 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||||| ||||||||||||||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
44144459 |
atttgcttagagcactacagttggcaataaaacatggataaaattaaaattagggaaggtgtcgagatttttgccaagctgaatatgaaattcaataaag |
44144558 |
T |
|
| Q |
103 |
tgaccatgaaataaagtaaggtgttccctcatctacccccatcatcatagagaagaagctttgcaagaaattttacttggcctgtaatttaacaagaagt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44144559 |
tgaccatgaaataaagtaaggtgttccctcatctacccccatcatcatagagaagaagctttgcaagaaattttacttggcctgtaatttaacaagaagt |
44144658 |
T |
|
| Q |
203 |
ttctctccttacatggattaaac |
225 |
Q |
| |
|
||||||||||| ||||||||||| |
|
|
| T |
44144659 |
ttctctccttagatggattaaac |
44144681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University