View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10284_low_5 (Length: 362)
Name: NF10284_low_5
Description: NF10284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10284_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 15 - 343
Target Start/End: Original strand, 30817826 - 30818154
Alignment:
| Q |
15 |
aggggaacttggctgcatcagttcgatgaactcgggtgccatttgagaaggtatgataaggaggacattgttcaagatggttgggtttgcacaacggttc |
114 |
Q |
| |
|
|||||||||||| ||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
30817826 |
aggggaacttggtcgcatcggttctgtgaactcgggtgccatttgagaaggtatgataaggaggacattgttcaagatggttgggtttgcacgacggttc |
30817925 |
T |
|
| Q |
115 |
agcttccgggtttatgtccatttcactgtatctggttacatcagatgtgacatccccatcgcatggctttccattgttcttccaacaacttcccatgtcc |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
30817926 |
agcttccgggtttatgtccatttcactgtatctggttacatcagatgtgacatccccatcgcacggctttccattgttcttccaacaacttcccatgtcc |
30818025 |
T |
|
| Q |
215 |
atgaggtagaattggctccttggaccccctcctttcttgatatcaagtgtgaaccttaccttaaaatgtggtgactttggtacaatttttgtcatgcctc |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30818026 |
atgaggtagaattggctccttggaccccctcctttcttgatatcaagtgtgaatcttaccttaaaatgtggtgactttggtacaatttttgtcatgcctc |
30818125 |
T |
|
| Q |
315 |
tagtttcataatggtaaccaccagagaat |
343 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
30818126 |
tagtttcataatggtaaccaccagagaat |
30818154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 47; Significance: 9e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 185 - 290
Target Start/End: Complemental strand, 38574746 - 38574641
Alignment:
| Q |
185 |
ccattgttcttccaacaacttcccatgtccatgaggtagaattggctccttggaccc-cctcctttcttgatatcaagtgtgaaccttaccttaaaatgt |
283 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||||||||||| ||||| || ||||||||||||| ||| | || ||||| |||||||||| | |
|
|
| T |
38574746 |
ccattgttcttccaacaacttcccatgtctagaaggtagaattggctc-ttggatcctcctcctttcttgacatctaaggttaacctcaccttaaaattt |
38574648 |
T |
|
| Q |
284 |
ggtgact |
290 |
Q |
| |
|
||||||| |
|
|
| T |
38574647 |
ggtgact |
38574641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University