View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10285_high_1 (Length: 355)
Name: NF10285_high_1
Description: NF10285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10285_high_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 69 - 344
Target Start/End: Complemental strand, 12681021 - 12680746
Alignment:
| Q |
69 |
ctttctttcccattgagaatctttgcagggttaaatttgttcctttctctccctaaatgggtctctagtagtacagaattaatgccggaacagctcaagt |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12681021 |
ctttctttcccattgagaatctttgcagggttaaatttgttcctttctctccctaaatgggtctctagtagtacagaattaatgccggaacagctcaagt |
12680922 |
T |
 |
| Q |
169 |
ttggccacatgcaaaataggttgggaacatgtacggtttggtatacacctttcatgttaccctttatccttatgtgttgaattattgattacctgatttg |
268 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12680921 |
ttggccacatgcaaaatagcttgggaacatgtacggtttggtatacacctttcatgttaccctttatccttatgtgttgaattattgattacctgatttg |
12680822 |
T |
 |
| Q |
269 |
gttgtgcacagttaatcatctagagtcacttcttggaataattcgaaagggtaccctgcatcttaaaccttttctt |
344 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12680821 |
gttgtgcacagttaatcatctagagtcacttcttggaataattcgaaagggtaccctgcatcttaaaccttttctt |
12680746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University