View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10285_high_10 (Length: 238)
Name: NF10285_high_10
Description: NF10285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10285_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 17 - 221
Target Start/End: Complemental strand, 14271887 - 14271683
Alignment:
| Q |
17 |
taggagctggaaaactcgacatgttaggaatatacatgcaaagatcatgggtgatactattttccatggcatttccactatgccttttatacatcttcgc |
116 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14271887 |
taggagcaggaaaactcgacatgttaggaatatacatgcaaagatcatgggtgatactattttccatggcatttccactatgccttttatacatcttcgc |
14271788 |
T |
 |
| Q |
117 |
cggatccgttctaaaattcataggacaaacaactgaaatatccgaggctgcaggaacatttgctttatatatgattccacaattatttgcttacgcgctg |
216 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14271787 |
cggatccattctaaaattcataggacaaacaactgaaatatccgaggccgcaggaacattcgctttatatatgattccacaattatttgcttacgcgctg |
14271688 |
T |
 |
| Q |
217 |
aattt |
221 |
Q |
| |
|
||||| |
|
|
| T |
14271687 |
aattt |
14271683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 29112207 - 29112155
Alignment:
| Q |
19 |
ggagctggaaaactcgacatgttaggaatatacatgcaaagatcatgggtgat |
71 |
Q |
| |
|
||||| || ||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29112207 |
ggagcagggaaactagacatgttaggaatatacatgcaaagatcatggttgat |
29112155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University