View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10285_high_2 (Length: 336)
Name: NF10285_high_2
Description: NF10285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10285_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 18 - 323
Target Start/End: Original strand, 16509812 - 16510117
Alignment:
| Q |
18 |
cagagaagaaaaccgtttgtgatgatgaagtggaagtgttgaaggtggtgaaagggaaagcagctgtgagtgatgaagttagggttttgaaggtggtgaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16509812 |
cagagaagaaaaccgtttgtgatgatgaagtggaagtgttgaaggtggtgaaggggaaagaagctgtgagtgatgaagttagggttttgaaggtggtgaa |
16509911 |
T |
 |
| Q |
118 |
gaaggaggtagttgaggagaagaagattctgattccgaatctcgaggatggtgagtttcctgttgagcctgggtggtcattgttgggaaggaagattgag |
217 |
Q |
| |
|
||||||||||||||| ||||||||||| | |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16509912 |
gaaggaggtagttgaagagaagaagatccagattccgaatcttgaggatggtgagtttcctgttgagcctgggtggtcattgttgggaaggaagattgag |
16510011 |
T |
 |
| Q |
218 |
attgctacttctactgctaaaggagtgagaagattggttgataatgagattatttattttgattttccgaatccgcatacgtcgtataagtttcaatgga |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16510012 |
attgctacttctactgctaaaggagtgagaagattggtggataatgagattatttattttgattttccgaatccgcatacgtcgtataagtttcaatgga |
16510111 |
T |
 |
| Q |
318 |
ttgttc |
323 |
Q |
| |
|
| |||| |
|
|
| T |
16510112 |
tcgttc |
16510117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University