View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10285_high_8 (Length: 251)
Name: NF10285_high_8
Description: NF10285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10285_high_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 35 - 239
Target Start/End: Complemental strand, 43329462 - 43329262
Alignment:
| Q |
35 |
atgaatataaacaactagctagctaggattatgaattggaccttggaaacaacaaggaaatgatcttaaccacatgcggggacgaacttcaaaattcaac |
134 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43329462 |
atgaatataaacaactagctag----gattatgaattggaccttggaaacaacaaggaaatgatcttaaccacatgcggggaggaacttcaaaattcaac |
43329367 |
T |
|
| Q |
135 |
actagcttgccttggatatagaccttattattataaaaatgttattaagtgcataaggtggcactatatatcaatgtgattggttctcctttattgtctc |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43329366 |
actagcttgccttggatatagaccttattattataaaaatgttattaagtgcataaggtggcactatatatcaatgtgattggttctcctttattgtctc |
43329267 |
T |
|
| Q |
235 |
tgctc |
239 |
Q |
| |
|
||||| |
|
|
| T |
43329266 |
tgctc |
43329262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University