View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10285_low_10 (Length: 277)
Name: NF10285_low_10
Description: NF10285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10285_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 8 - 261
Target Start/End: Original strand, 5378888 - 5379142
Alignment:
| Q |
8 |
aagcaaagggtcccaagatactatttgtgtatagcaaatttggaattattggtggatttttccttctaagttgcnnnnnnnaggtactagagccaagtta |
107 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5378888 |
aagcatagggtcccaagatactatttgtgtatagcaaatttggaattattggtggatttttccttctaagttgctttttttaggtactagagccaagtta |
5378987 |
T |
 |
| Q |
108 |
gtcggatccaaatcacacacacaaaactttaccttttttgaagatgtttcttttcaactgttttgacttggctttgtgatttgaaacttgaaggcaggca |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5378988 |
gtcggatccaaatcacacacacaaaactttaccttttttgaagatgtttcttttcaactgttttgacttggctttgtgatttgaaacttgaaggcaggca |
5379087 |
T |
 |
| Q |
208 |
c-aaaaagcaaagctagtgaaatgatgaaagggtgaggtgcattttgaacttcag |
261 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5379088 |
caaaaaagcaaagctagtgaaatgatgaaagggtgaggtgcattttgaacttcag |
5379142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University